gfp pp2ac cdna  (OriGene)

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD25 and protein phosphatase 2A cooperate to enhance IL-2R signaling in human regulatory T cells

doi: 10.4049/jimmunol.1801570

Figure Lengend Snippet: Overexpression of PP2Ac activates JAK3/STAT5 signaling in human Tregs. Expanded human Tregs were lentiviral transduced with control vector or a plasmid encoding PP2Ac, and cultured in SFM with anti-CD3/CD28 beads and IL-2 for 3 days before analysis. (A) Transduction efficiency was assessed by the percentage of GFP+ cells. (B-D) Expression of PP2Ac in GFP+ cells was assessed at the mRNA and protein levels using qPCR (B), Western blotting (C), and flow cytometry (D) (n=3). (E) A representative immunoblot (left) and densitometry analysis of the resulting data (right) of protein extracts from transduced Tregs were probed for tyrosine-phosphorylated JAK3 (Tyr980/981), total JAK3, tyrosine-phosphorylated STAT5 (Tyr694), PP2Ac, and β-Tubulin (n=3). (F) IL-2-induced pSTAT5 dose-response curves of transduced Tregs (GFP+Foxp3+) (left) and nonlinear regression analysis of the binding data (middle) to determine EC50 (right) for IL-2-induced pSTAT5 activation (n=6). Data in plots are shown as means ± SEM and were analyzed by a one-sample two-tailed t test (B-F). *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; ns, not significant.

Article Snippet: The full coding sequences of human PP2Ac was PCR amplified from PP2Ac-alpha (PPP2CA) ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002715","term_id":"1519312245","term_text":"NM_002715"}} NM_002715 ) human untagged clone (# SC321401, Origene, Rockville, MD) using the following primers: PPP2CA - cloning-for 5’- TATGGATCCATGGACGAGAAGGTGTTCACCAAGG-3’; PPP2CA - cloning-rev 5’- GTGTGGAATTCTTACAGGAAGTAGTCTGGGGTACGACG −3’.

Techniques: Over Expression, Transduction, Control, Plasmid Preparation, Cell Culture, Expressing, Western Blot, Flow Cytometry, Binding Assay, Activation Assay, Two Tailed Test

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD25 and protein phosphatase 2A cooperate to enhance IL-2R signaling in human regulatory T cells

doi: 10.4049/jimmunol.1801570

Figure Lengend Snippet: Overexpression of PP2Ac upregulates IL-2-dependent genes in human Tregs. Tregs from different healthy adult donors (n=3) were expanded and lentiviral transduced in vitro. Total RNA was isolated from vector-transduced or PP2Ac-overexpressed Tregs 3 days after lentiviral transduction and analyzed by real-time qPCR. Data were normalized to the mRNA level in the control vector-transduced cells. The sample in each graph with the highest fold change is from the same donor.

Article Snippet: The full coding sequences of human PP2Ac was PCR amplified from PP2Ac-alpha (PPP2CA) ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002715","term_id":"1519312245","term_text":"NM_002715"}} NM_002715 ) human untagged clone (# SC321401, Origene, Rockville, MD) using the following primers: PPP2CA - cloning-for 5’- TATGGATCCATGGACGAGAAGGTGTTCACCAAGG-3’; PPP2CA - cloning-rev 5’- GTGTGGAATTCTTACAGGAAGTAGTCTGGGGTACGACG −3’.

Techniques: Over Expression, In Vitro, Isolation, Plasmid Preparation, Transduction, Control

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD25 and protein phosphatase 2A cooperate to enhance IL-2R signaling in human regulatory T cells

doi: 10.4049/jimmunol.1801570

Figure Lengend Snippet: Increased expression of CD25 induced by PP2Ac overexpression does not fully account for enhanced pSTAT5 activation. Expanded human Tregs from different healthy adult donors (n=4) were lentiviral transduced with control vector or a plasmid encoding PP2Ac, and analyzed 3 days later. (A) CD25 level of Foxp3+ GFP+ transduced Tregs. Numbers represent MFI of CD25 for the indicated cell population. (B) Representative gating strategy of FACS plots to identify transduced Tregs with a similar MFI of CD25 (represented in the P5 gate). (C) IL-2-induced pSTAT5 dose-response curves (left) of control or PP2Ac-overexpressed Tregs with similar CD25 levels, as shown in Fig. 5B. Nonlinear regression analysis of the binding data (middle) was conducted to determine the EC50 (right) for IL-2-induced pSTAT5. (D) MFI of pSTAT5 vs. CD25 levels in control and PP2Ac-overexpressed Tregs after stimulation with IL-2 (1 unit/mL) for 15 min (n=4). Representative gating strategy (left) and quantified data (right) where the MFI of CD25 was normalized to 1 based for the gated cell with the lowest amount of CD25. Data (C, D) are shown as means ± SEM and were analyzed by one-sample two-tailed t test (C) or a paired two-tailed t test (D). *P < 0.05, **P < 0.01, ****P<0.0001.

Article Snippet: The full coding sequences of human PP2Ac was PCR amplified from PP2Ac-alpha (PPP2CA) ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002715","term_id":"1519312245","term_text":"NM_002715"}} NM_002715 ) human untagged clone (# SC321401, Origene, Rockville, MD) using the following primers: PPP2CA - cloning-for 5’- TATGGATCCATGGACGAGAAGGTGTTCACCAAGG-3’; PPP2CA - cloning-rev 5’- GTGTGGAATTCTTACAGGAAGTAGTCTGGGGTACGACG −3’.

Techniques: Expressing, Over Expression, Activation Assay, Transduction, Control, Plasmid Preparation, Binding Assay, Two Tailed Test

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD25 and protein phosphatase 2A cooperate to enhance IL-2R signaling in human regulatory T cells

doi: 10.4049/jimmunol.1801570

Figure Lengend Snippet: PP2Ac increases survival, activation, and immunosuppressive function of human Tregs. Representative histograms (A) and quantitative evaluation (B) of expression of the indicated markers for control and PP2Ac-overexpressed Tregs (n=4). (C) In vitro suppression assay of CD8+ T cells (responders) by control or PP2Ac-overexpressed Tregs (n=3). Data (B, C) are shown as means ± SEM and were analyzed by a one-sample two-tailed t test (B) or an unpaired two-tailed t test (C).*P < 0.05, **P < 0.01, ***P<0.001, ns, not significant.

Article Snippet: The full coding sequences of human PP2Ac was PCR amplified from PP2Ac-alpha (PPP2CA) ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002715","term_id":"1519312245","term_text":"NM_002715"}} NM_002715 ) human untagged clone (# SC321401, Origene, Rockville, MD) using the following primers: PPP2CA - cloning-for 5’- TATGGATCCATGGACGAGAAGGTGTTCACCAAGG-3’; PPP2CA - cloning-rev 5’- GTGTGGAATTCTTACAGGAAGTAGTCTGGGGTACGACG −3’.

Techniques: Activation Assay, Expressing, Control, In Vitro, Suppression Assay, Two Tailed Test

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD25 and protein phosphatase 2A cooperate to enhance IL-2R signaling in human regulatory T cells

doi: 10.4049/jimmunol.1801570

Figure Lengend Snippet: Knockdown of PP2Ac reduces pSTAT5 response to IL-2 by human Tregs. Expanded human Tregs were lentiviral transduced with control or PP2Ac shRNA and analyzed after 3 days. (A) Transduction efficiency was assessed by the percentage of GFP+ cells. (B) Expression of PP2Ac was assessed by qPCR (n=3), western blotting (n=3), and flow cytometry (n=3) in control and PP2Ac knockdown Tregs. (C) FACS gating strategy for pSTAT5 activation analysis. Tregs transduced with PP2Ac shRNA were gated into two groups according to the knockdown efficiency. Numbers represent MFI of PP2Ac for the indicated cell population. (D) IL-2-induced pSTAT5 dose-response curves (left) for the indicated group of Tregs shown in Fig. 7C (n=6). Nonlinear regression analysis of the binding data (middle) was used to determine EC50 (right) (E) Representative histograms (left) and quantitative evaluation (right) of pSTAT5 MFI for indicated cell population after treatment with 40 and 400 pM of IL-2 (n=6). The numbers represent MFI of the gated pSTAT5+ cells. (F) Representative histograms of IL-2R subunit expression on control and PP2Ac shRNA transduced Tregs. Data (B-E) are shown as means ± SEM and were analyzed by a one-sample two-tailed t test (B, D-E) or an unpaired two-tailed t test (D).*P < 0.05, **P < 0.01, ***P<0.001, ****P<0.0001, ns, not significant;

Article Snippet: The full coding sequences of human PP2Ac was PCR amplified from PP2Ac-alpha (PPP2CA) ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002715","term_id":"1519312245","term_text":"NM_002715"}} NM_002715 ) human untagged clone (# SC321401, Origene, Rockville, MD) using the following primers: PPP2CA - cloning-for 5’- TATGGATCCATGGACGAGAAGGTGTTCACCAAGG-3’; PPP2CA - cloning-rev 5’- GTGTGGAATTCTTACAGGAAGTAGTCTGGGGTACGACG −3’.

Techniques: Knockdown, Transduction, Control, shRNA, Expressing, Western Blot, Flow Cytometry, Activation Assay, Binding Assay, Two Tailed Test

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD25 and protein phosphatase 2A cooperate to enhance IL-2R signaling in human regulatory T cells

doi: 10.4049/jimmunol.1801570

Figure Lengend Snippet: Overexpression and knockdown of PP2Ac does not alter pSTAT5 response to IL-2 by human Teff cells. (A-B) Expression of PP2Ac in freshly isolated Treg and TEM cells were assessed using Western blotting (n=3) (A) and flow cytometry (n=3) (B). (C) Quantification of the enzymatic activity of PP2A in freshly isolated Treg and TEM cells (n=3). (D, E) Transduction efficiency in vector-transduced and PP2Ac-overexpressed Teff cells (D) or in control and PP2Ac shRNA-transduced cells (E) was assessed by the percentage of GFP+ cells. (F, G) PP2Ac expression in control and PP2Ac-transduced overexpressed cells (F) or in control and PP2Ac shRNA knockdown cells (G) was assessed by flow cytometry (n=3). Teff cells transduced with PP2Ac shRNA were gated into two groups according to the knockdown efficiency and this gating strategy was used for pSTAT5 analysis in Fig. 8K. (H, I) Representative histograms for CD25 expression for control and PP2Ac-overexpressed (H) or for control and PP2Ac shRNA transduced Teff cells (I). The numbers in the FACS plots are the MFI of CD25 for the indicated cell populations. (J, K) IL-2-induced pSTAT5 dose-response curves (left) of control and PP2Ac-overexpressed (J) or control and PP2Ac shRNA transduced Teff cells (K). Nonlinear regression analysis of the binding data (middle) was performed to determine EC50 (right) (n=3). Data (A-C, F, G, J, K) are shown as the means ± SEM and were analyzed by a one-sample two-tailed t test (A-C, F, J, K).. *P < 0.05; ***P < 0.001; ns, not significant.

Article Snippet: The full coding sequences of human PP2Ac was PCR amplified from PP2Ac-alpha (PPP2CA) ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002715","term_id":"1519312245","term_text":"NM_002715"}} NM_002715 ) human untagged clone (# SC321401, Origene, Rockville, MD) using the following primers: PPP2CA - cloning-for 5’- TATGGATCCATGGACGAGAAGGTGTTCACCAAGG-3’; PPP2CA - cloning-rev 5’- GTGTGGAATTCTTACAGGAAGTAGTCTGGGGTACGACG −3’.

Techniques: Over Expression, Knockdown, Expressing, Isolation, Western Blot, Flow Cytometry, Activity Assay, Transduction, Plasmid Preparation, Control, shRNA, Binding Assay, Two Tailed Test

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD25 and protein phosphatase 2A cooperate to enhance IL-2R signaling in human regulatory T cells

doi: 10.4049/jimmunol.1801570

Figure Lengend Snippet: Overexpression of PP2Ac activates JAK3/STAT5 signaling in human Tregs. Expanded human Tregs were lentiviral transduced with control vector or a plasmid encoding PP2Ac, and cultured in SFM with anti-CD3/CD28 beads and IL-2 for 3 days before analysis. (A) Transduction efficiency was assessed by the percentage of GFP+ cells. (B-D) Expression of PP2Ac in GFP+ cells was assessed at the mRNA and protein levels using qPCR (B), Western blotting (C), and flow cytometry (D) (n=3). (E) A representative immunoblot (left) and densitometry analysis of the resulting data (right) of protein extracts from transduced Tregs were probed for tyrosine-phosphorylated JAK3 (Tyr980/981), total JAK3, tyrosine-phosphorylated STAT5 (Tyr694), PP2Ac, and β-Tubulin (n=3). (F) IL-2-induced pSTAT5 dose-response curves of transduced Tregs (GFP+Foxp3+) (left) and nonlinear regression analysis of the binding data (middle) to determine EC50 (right) for IL-2-induced pSTAT5 activation (n=6). Data in plots are shown as means ± SEM and were analyzed by a one-sample two-tailed t test (B-F). *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; ns, not significant.

Article Snippet: The full coding sequences of human PP2Ac was PCR amplified from PP2Ac-alpha (PPP2CA) ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002715","term_id":"1519312245","term_text":"NM_002715"}} NM_002715 ) human untagged clone (# SC321401, Origene, Rockville, MD) using the following primers: PPP2CA - cloning-for 5’- TATGGATCCATGGACGAGAAGGTGTTCACCAAGG-3’; PPP2CA - cloning-rev 5’- GTGTGGAATTCTTACAGGAAGTAGTCTGGGGTACGACG −3’.

Techniques: Over Expression, Transduction, Plasmid Preparation, Cell Culture, Expressing, Western Blot, Flow Cytometry, Binding Assay, Activation Assay, Two Tailed Test

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD25 and protein phosphatase 2A cooperate to enhance IL-2R signaling in human regulatory T cells

doi: 10.4049/jimmunol.1801570

Figure Lengend Snippet: Overexpression of PP2Ac upregulates IL-2-dependent genes in human Tregs. Tregs from different healthy adult donors (n=3) were expanded and lentiviral transduced in vitro. Total RNA was isolated from vector-transduced or PP2Ac-overexpressed Tregs 3 days after lentiviral transduction and analyzed by real-time qPCR. Data were normalized to the mRNA level in the control vector-transduced cells. The sample in each graph with the highest fold change is from the same donor.

Article Snippet: The full coding sequences of human PP2Ac was PCR amplified from PP2Ac-alpha (PPP2CA) ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002715","term_id":"1519312245","term_text":"NM_002715"}} NM_002715 ) human untagged clone (# SC321401, Origene, Rockville, MD) using the following primers: PPP2CA - cloning-for 5’- TATGGATCCATGGACGAGAAGGTGTTCACCAAGG-3’; PPP2CA - cloning-rev 5’- GTGTGGAATTCTTACAGGAAGTAGTCTGGGGTACGACG −3’.

Techniques: Over Expression, In Vitro, Isolation, Plasmid Preparation, Transduction

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD25 and protein phosphatase 2A cooperate to enhance IL-2R signaling in human regulatory T cells

doi: 10.4049/jimmunol.1801570

Figure Lengend Snippet: Increased expression of CD25 induced by PP2Ac overexpression does not fully account for enhanced pSTAT5 activation. Expanded human Tregs from different healthy adult donors (n=4) were lentiviral transduced with control vector or a plasmid encoding PP2Ac, and analyzed 3 days later. (A) CD25 level of Foxp3+ GFP+ transduced Tregs. Numbers represent MFI of CD25 for the indicated cell population. (B) Representative gating strategy of FACS plots to identify transduced Tregs with a similar MFI of CD25 (represented in the P5 gate). (C) IL-2-induced pSTAT5 dose-response curves (left) of control or PP2Ac-overexpressed Tregs with similar CD25 levels, as shown in Fig. 5B. Nonlinear regression analysis of the binding data (middle) was conducted to determine the EC50 (right) for IL-2-induced pSTAT5. (D) MFI of pSTAT5 vs. CD25 levels in control and PP2Ac-overexpressed Tregs after stimulation with IL-2 (1 unit/mL) for 15 min (n=4). Representative gating strategy (left) and quantified data (right) where the MFI of CD25 was normalized to 1 based for the gated cell with the lowest amount of CD25. Data (C, D) are shown as means ± SEM and were analyzed by one-sample two-tailed t test (C) or a paired two-tailed t test (D). *P < 0.05, **P < 0.01, ****P<0.0001.

Article Snippet: The full coding sequences of human PP2Ac was PCR amplified from PP2Ac-alpha (PPP2CA) ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002715","term_id":"1519312245","term_text":"NM_002715"}} NM_002715 ) human untagged clone (# SC321401, Origene, Rockville, MD) using the following primers: PPP2CA - cloning-for 5’- TATGGATCCATGGACGAGAAGGTGTTCACCAAGG-3’; PPP2CA - cloning-rev 5’- GTGTGGAATTCTTACAGGAAGTAGTCTGGGGTACGACG −3’.

Techniques: Expressing, Over Expression, Activation Assay, Transduction, Plasmid Preparation, Binding Assay, Two Tailed Test

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD25 and protein phosphatase 2A cooperate to enhance IL-2R signaling in human regulatory T cells

doi: 10.4049/jimmunol.1801570

Figure Lengend Snippet: PP2Ac increases survival, activation, and immunosuppressive function of human Tregs. Representative histograms (A) and quantitative evaluation (B) of expression of the indicated markers for control and PP2Ac-overexpressed Tregs (n=4). (C) In vitro suppression assay of CD8+ T cells (responders) by control or PP2Ac-overexpressed Tregs (n=3). Data (B, C) are shown as means ± SEM and were analyzed by a one-sample two-tailed t test (B) or an unpaired two-tailed t test (C).*P < 0.05, **P < 0.01, ***P<0.001, ns, not significant.

Article Snippet: The full coding sequences of human PP2Ac was PCR amplified from PP2Ac-alpha (PPP2CA) ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002715","term_id":"1519312245","term_text":"NM_002715"}} NM_002715 ) human untagged clone (# SC321401, Origene, Rockville, MD) using the following primers: PPP2CA - cloning-for 5’- TATGGATCCATGGACGAGAAGGTGTTCACCAAGG-3’; PPP2CA - cloning-rev 5’- GTGTGGAATTCTTACAGGAAGTAGTCTGGGGTACGACG −3’.

Techniques: Activation Assay, Expressing, In Vitro, Suppression Assay, Two Tailed Test

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD25 and protein phosphatase 2A cooperate to enhance IL-2R signaling in human regulatory T cells

doi: 10.4049/jimmunol.1801570

Figure Lengend Snippet: Knockdown of PP2Ac reduces pSTAT5 response to IL-2 by human Tregs. Expanded human Tregs were lentiviral transduced with control or PP2Ac shRNA and analyzed after 3 days. (A) Transduction efficiency was assessed by the percentage of GFP+ cells. (B) Expression of PP2Ac was assessed by qPCR (n=3), western blotting (n=3), and flow cytometry (n=3) in control and PP2Ac knockdown Tregs. (C) FACS gating strategy for pSTAT5 activation analysis. Tregs transduced with PP2Ac shRNA were gated into two groups according to the knockdown efficiency. Numbers represent MFI of PP2Ac for the indicated cell population. (D) IL-2-induced pSTAT5 dose-response curves (left) for the indicated group of Tregs shown in Fig. 7C (n=6). Nonlinear regression analysis of the binding data (middle) was used to determine EC50 (right) (E) Representative histograms (left) and quantitative evaluation (right) of pSTAT5 MFI for indicated cell population after treatment with 40 and 400 pM of IL-2 (n=6). The numbers represent MFI of the gated pSTAT5+ cells. (F) Representative histograms of IL-2R subunit expression on control and PP2Ac shRNA transduced Tregs. Data (B-E) are shown as means ± SEM and were analyzed by a one-sample two-tailed t test (B, D-E) or an unpaired two-tailed t test (D).*P < 0.05, **P < 0.01, ***P<0.001, ****P<0.0001, ns, not significant;

Article Snippet: The full coding sequences of human PP2Ac was PCR amplified from PP2Ac-alpha (PPP2CA) ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002715","term_id":"1519312245","term_text":"NM_002715"}} NM_002715 ) human untagged clone (# SC321401, Origene, Rockville, MD) using the following primers: PPP2CA - cloning-for 5’- TATGGATCCATGGACGAGAAGGTGTTCACCAAGG-3’; PPP2CA - cloning-rev 5’- GTGTGGAATTCTTACAGGAAGTAGTCTGGGGTACGACG −3’.

Techniques: Transduction, shRNA, Expressing, Western Blot, Flow Cytometry, Activation Assay, Binding Assay, Two Tailed Test

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD25 and protein phosphatase 2A cooperate to enhance IL-2R signaling in human regulatory T cells

doi: 10.4049/jimmunol.1801570

Figure Lengend Snippet: Overexpression and knockdown of PP2Ac does not alter pSTAT5 response to IL-2 by human Teff cells. (A-B) Expression of PP2Ac in freshly isolated Treg and TEM cells were assessed using Western blotting (n=3) (A) and flow cytometry (n=3) (B). (C) Quantification of the enzymatic activity of PP2A in freshly isolated Treg and TEM cells (n=3). (D, E) Transduction efficiency in vector-transduced and PP2Ac-overexpressed Teff cells (D) or in control and PP2Ac shRNA-transduced cells (E) was assessed by the percentage of GFP+ cells. (F, G) PP2Ac expression in control and PP2Ac-transduced overexpressed cells (F) or in control and PP2Ac shRNA knockdown cells (G) was assessed by flow cytometry (n=3). Teff cells transduced with PP2Ac shRNA were gated into two groups according to the knockdown efficiency and this gating strategy was used for pSTAT5 analysis in Fig. 8K. (H, I) Representative histograms for CD25 expression for control and PP2Ac-overexpressed (H) or for control and PP2Ac shRNA transduced Teff cells (I). The numbers in the FACS plots are the MFI of CD25 for the indicated cell populations. (J, K) IL-2-induced pSTAT5 dose-response curves (left) of control and PP2Ac-overexpressed (J) or control and PP2Ac shRNA transduced Teff cells (K). Nonlinear regression analysis of the binding data (middle) was performed to determine EC50 (right) (n=3). Data (A-C, F, G, J, K) are shown as the means ± SEM and were analyzed by a one-sample two-tailed t test (A-C, F, J, K).. *P < 0.05; ***P < 0.001; ns, not significant.

Article Snippet: The full coding sequences of human PP2Ac was PCR amplified from PP2Ac-alpha (PPP2CA) ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002715","term_id":"1519312245","term_text":"NM_002715"}} NM_002715 ) human untagged clone (# SC321401, Origene, Rockville, MD) using the following primers: PPP2CA - cloning-for 5’- TATGGATCCATGGACGAGAAGGTGTTCACCAAGG-3’; PPP2CA - cloning-rev 5’- GTGTGGAATTCTTACAGGAAGTAGTCTGGGGTACGACG −3’.

Techniques: Over Expression, Expressing, Isolation, Western Blot, Flow Cytometry, Activity Assay, Transduction, Plasmid Preparation, shRNA, Binding Assay, Two Tailed Test

Journal: Frontiers in Pharmacology

Article Title: Cornel Iridoid Glycoside Inhibits Tau Hyperphosphorylation via Regulating Cross-Talk Between GSK-3β and PP2A Signaling

doi: 10.3389/fphar.2018.00682

Figure Lengend Snippet: Primary antibodies used in this study.

Article Snippet: HEK-293T cells were transfected with human tau40 plasmid together with human PP2Ac siRNA (QIAGEN, Hilden, Germany).

Techniques: Methylation

Journal: Frontiers in Pharmacology

Article Title: Cornel Iridoid Glycoside Inhibits Tau Hyperphosphorylation via Regulating Cross-Talk Between GSK-3β and PP2A Signaling

doi: 10.3389/fphar.2018.00682

Figure Lengend Snippet: Cornel iridoid glycoside inhibits GSK-3β through decreasing PP2Ac demethylation to suppress tau hyperphosphorylation. (A,B) The phosphorylation at different sits of tau protein in HEK-293T cells transfected with wild type GSK-3β plasmid together with human tau40 plasmid was detected by western blotting assay. CIG at different doses was incubated with transfected cells for 24 h. (C,D) The levels of GSK-3β and phosphorylated GSK-3β at Ser9 site in GSK-3β-transfected cells. (E,F) Quantitative analysis of AKT and phosphorylated AKT at Ser473 in the cells transfected with GSK-3β plasmid. (G,H) The levels of PP2A catalytic C subunit (PP2Ac) and demethylated PP2Ac (dm-PP2Ac) at Leu309 site in cells transfected with GSK-3β plasmid. (I,J) The levels of PP2Ac and dm-PP2Ac at Leu309 in the hippocampus of rats intraventricularly injected with wortmannin/GFX. (K,L) The levels of GSK-3β and phosphorylated GSK-3β at Ser9 in HEK-293T cells transfected with PP2Ac siRNA. GAPDH was used as an internal control, and the expression level of control group was set as 100%. We detected p-tau and PP2Ac in the same electrophoresis and on the same membrane using different antibodies, and used the same loading control GAPDH in (A,G) . Data are present as mean ± SD; n = 3–4 each group. # P < 0.05, ## P < 0.01, the model group compared with the control group; ∗ P < 0.05, ∗∗ P < 0.01, drug groups compared with the model group. WTM, wortmannin; GFX, GF-109203X; MEM, memantine, 3 mg/kg.

Article Snippet: HEK-293T cells were transfected with human tau40 plasmid together with human PP2Ac siRNA (QIAGEN, Hilden, Germany).

Techniques: Transfection, Plasmid Preparation, Western Blot, Incubation, Injection, Expressing, Electrophoresis

Journal: Frontiers in Pharmacology

Article Title: Cornel Iridoid Glycoside Inhibits Tau Hyperphosphorylation via Regulating Cross-Talk Between GSK-3β and PP2A Signaling

doi: 10.3389/fphar.2018.00682

Figure Lengend Snippet: Cornel iridoid glycoside enhances PP2A activity through inhibiting PP2Ac demethylation directly. (A) The morphological changes of human neuroblastoma SK-N-SH cells exposed to okadaic acid (OA) at the dose of 20 nM for 6 h were observed under contrast microscope (Scale bar = 50 μm). CIG at different doses was preincubated with cells for 24 h. (B,C) The phosphorylation of different sites of tau protein in OA-induced model cells was detected by western blotting assay. (D) The activity of PP2A was measured by a biochemical assay ( n = 6 each group). (E,F) The levels of PP2Ac and demethylated PP2Ac (dm-PP2Ac) at Leu309 site were detected by western blotting. (G,H) The level of PP2Ac in HEK-293 cells transfected with PP2Ac siRNA. CIG was incubated with transfected cells for 24 h. (I,J) The phosphorylation of tau protein in PP2Ac siRNAc-transfected cells. GAPDH was used as an internal control, and the expression level of control group was set as 100%. We detected p-tau and PP2Ac in the same electrophoresis and on the same membrane using different antibodies, and used the same loading control GAPDH in (B,E) . Data represent mean ± SD; n = 3–4 each group. #P < 0.05, ##P < 0.01, the model group compared with the control group; ∗ P < 0.05, ∗∗ P < 0.01, drug groups compared with the model group.

Article Snippet: HEK-293T cells were transfected with human tau40 plasmid together with human PP2Ac siRNA (QIAGEN, Hilden, Germany).

Techniques: Activity Assay, Microscopy, Western Blot, Transfection, Incubation, Expressing, Electrophoresis

Journal: Frontiers in Pharmacology

Article Title: Cornel Iridoid Glycoside Inhibits Tau Hyperphosphorylation via Regulating Cross-Talk Between GSK-3β and PP2A Signaling

doi: 10.3389/fphar.2018.00682

Figure Lengend Snippet: Cornel iridoid glycoside inhibits demethylation of PP2Ac via decreasing PME-1. (A,B) The expression of PME-1 and LCMT-1 in OA-treated SK-N-SH cells, and the ratio of PME-1/LCMT-1. (C,D) The expression of PME-1 in mouse neuroblastoma N2a cells transduced with PME-1 genetic materials delivered by recombined lentivirus vector. CIG was incubated with the transduced cells for 24 h. (E,F) The expression of LCMT-1 in N2a cells transduced with PME-1 genetic materials. (G,H) The expression of demethylated PP2Ac (dm-PP2Ac) and methylated PP2Ac (m-PP2Ac). (I) The activity of PP2A measured by a biochemical assay, n = 6 per group. (J,K) The phosphorylation of tau at Thr217 (pT217). GAPDH was used as an internal control, and the expression level of control group was set as 100%. Data are expressed as mean ± SD; n = 3–4 each group. # P < 0.05, ## P < 0.01, the model group compared with the control group; ∗ P < 0.05, ∗∗ P < 0.01, drug groups compared with the model group.

Article Snippet: HEK-293T cells were transfected with human tau40 plasmid together with human PP2Ac siRNA (QIAGEN, Hilden, Germany).

Techniques: Expressing, Transduction, Plasmid Preparation, Incubation, Methylation, Activity Assay

Journal: Frontiers in Pharmacology

Article Title: Cornel Iridoid Glycoside Inhibits Tau Hyperphosphorylation via Regulating Cross-Talk Between GSK-3β and PP2A Signaling

doi: 10.3389/fphar.2018.00682

Figure Lengend Snippet: Cornel iridoid glycoside inhibits demethylation of PP2Ac not entirely dependent on LCMT-1. (A,B) The expression of LCMT-1 in LCMT-1 siRNA-transfected HEK-293T cells detected by western blotting assay. CIG was incubated with the transfected cells for 24 h. (C,D) The expression of demethylated PP2Ac (dm-PP2Ac) and methylated PP2Ac (m-PP2Ac) in the transfected cells. (E) The activity of PP2A measured by a biochemical assay, n = 6 each group. (F,G) The phosphorylation of tau at Thr217 (pT217). GAPDH was used as an internal control, and the expression level of control group was set as 100%. Data represent mean ± SD; n = 3–4 each group. # P < 0.05, ## P < 0.01, the model group compared with the control group; ∗ P < 0.05, ∗∗ P < 0.01, drug groups compared with the model cells.

Article Snippet: HEK-293T cells were transfected with human tau40 plasmid together with human PP2Ac siRNA (QIAGEN, Hilden, Germany).

Techniques: Expressing, Transfection, Western Blot, Incubation, Methylation, Activity Assay